Sale!

Webcam HD 1080p Web Camera with Microphophon

Original price was: $25.99.Current price is: $19.99.

Rated 5.00 out of 5 based on 3 customer ratings

(4 customer reviews)

【1080P Full Hd Webcam 】: 1080P Web Camera, Fixed focus, crystal clear video at a fluid 30 frames/sec, specifically designed for Video Calling, Recording, Conferencing, Gaming. Equipped with Automatic Light Correction and hdr technology, auto adjusts color and brightness 【Easy to Set Up】: Usb webcam can be easily installed and use, Fixed focus, plug and play, No additional driver required. for laptops, desktops, computers, Mac, PC. 【Webcam with Stereo Microphone】webcam with automatic noise reduction makes the sound clearer and more natural even in the noise environment 【Privacy protection】1080p Hd Webcam comes with a Privacy Cover, ensure the safety of customers, their loved ones, homes, and businesses, Provides security, privacy, and ease of mind

Add to wishlist

Category: shop

Additional information
Reviews (4)

Additional information

Weight	5.2 oz

4 reviews for Webcam HD 1080p Web Camera with Microphophon

Based on 3 rating(s)

Quality

100%

Service

100%

Easy Clean

100%

Reviewed by 02 customer(s)

Sort by

* * * GET FREE iPhone 15: http://infointensify.com/uploads/go.php * * * hs=5619b1bc4a1c03010f5af9dc7196833b*

ff0csc

February 15, 2024
Get free iPhone

jq8x6h

November 8, 2023
ldzULWG

The human GAPDH forward, 5 ATGCTGGCGCTGAGTACGTC 3, reverse, 5 GGTCATGAGTCCTTCCACGATA 3 gene was used as an internal reference how to buy priligy in usa reviews Fall Syncope Blood copper increased Sinusitis Osteonecrosis Blood creatinine increased Compression fracture Mental status changes Osteomyelitis Spinal disorder

August 26, 2023
tUfmMAQs

priligy for pe Comparing the transcript levels between the myocytes from the GoF and LoF mice identified differential expression of about 1100 genes, comprising 731 upregulated and 345 downregulated genes Figure 3C

July 24, 2023

Kaslove LLC US Online Passport photo prints 2×2 inch, VISA, Citizenship, Immigration, Work Photos , green card photo
- 1-Please do not use glasses in your passport photo 2- Stand by a wall and take your picture 3- Please take your photo from the waist up 4- Do not zoom in on the phone or camera to take a picture, but approach the subject yourself 5- Please do not bend your head and look directly at the camera 6- Please let us if you want another photo size 7- Everyone is responsible for their own photo because we did not take the photo, So we design and print the same photo
- Save Time and Money – Take your own Best Photo Conveniently without Leaving Home Background:- Cream or Light Grey. We will edit and re-size your image as per required specification. After photo is taken simply attach and attache to amazon In one print you will have 6 passport photos, which will be delivered to your given address. Passport photo size 2*2 inch
- 1)Take a photo from your mobile phone or camera in the comfort of your home 2) Take the photo against any Cream or Light Grey wall in your home, preferably on a bright sunny day. 3) Message it to us and we will resize it. 4) Upon payment, we will post your passport photos to you within 24 hrs. 5) Photos will come cut to exact size unless specified otherwise, IE You can have them on the sheet to cut yourself if required. 6) Center & face camera (do not tilt head to either side)
- What your printed photos must show: – Your photos must: Be a close-up of your full head and upper shoulders. Contain no other objects or people. Be taken against a plain cream or light grey background. Be in clear contrast to the background Not have ‘red eye’. In your photo, you must: Be facing forwards and looking straight at the camera
- Have a plain expression and your mouth closed. Have your eyes open and visible. Not have hair in front of your eyes. Not have a head covering (unless it’s for religious or medical reasons). Not have anything covering your face. Not have any shadows on your face or behind you. This is the price for a personal photo Do not wear sunglasses or tinted glasses. reflection. Over 17 years’ experience.
- For all Ages
- Choose the Right Background:
  - Opt for a plain, light-colored background, such as white or light blue, to meet passport photo requirements.
- Proper Lighting is Key:
  - Ensure even, natural lighting to avoid shadows on your face. Avoid harsh overhead lighting or direct sunlight.
- Maintain Facial Expression:
  - Keep a neutral expression, with both eyes open and facing the camera. Avoid smiling, frowning, or any exaggerated expressions.
- Position Your Head Correctly:
  - Center your face within the frame, and maintain a head-and-shoulders shot. Ensure your head is not tilted and faces the camera directly.
- Wear Appropriate Clothing:
  - Choose clothing with solid colors and avoid patterns. Dark colors are often recommended, but check specific guidelines for your country.
- Follow Size and Composition Guidelines:
  - Be aware of the required photo dimensions and composition specifications mandated by your country’s passport photo regulations.
- Use a High-Resolution Camera:
  - Employ a good-quality camera or smartphone with a high-resolution setting to capture clear and sharp images.
- Avoid Red-Eye and Glare:
  - Ensure your eyes are free from red-eye, and use anti-glare settings to minimize reflections on glasses if worn.
- Maintain Natural Skin Tone:
  - Avoid excessive use of filters or editing tools that alter your natural skin tone. The photo should represent your true appearance.
- Review Guidelines for Expression and Attire:
  - Check specific requirements for your country or region regarding permissible facial expressions, head coverings, and other attire considerations
Add to Cart
4 Pack Business Card Holder Mesh Card Stand Desk Desktop Organizer Black Large Capacity for Office Name Card

Simple, clean mesh design goes with any office Keep business cards handy and ready to give out. Open design allows for easy browsing Features double-rimmed, smooth edges and a powder-coat finish. Durable, black, metal wire mesh construction Measures 3.8 by 3 by 1.8 inches (LxWxH). Hold approximately 50 cards Lifetime Guarantee: If you experience an […]

Add to Cart
400 Packs Gift Card Envelopes Kraft Envelopes Mini Paper Card Envelope Sleeve for Small Gift Cards Invitations Business Notes Tiny Mini Greeting Cards, 4 x 2.75 inches (Brown)

What you will receive: you will get 400 packs mini brown Kraft envelopes for various purposes, like using them holding gift cards, greeting cards, etc. to send your friendliness to the one your care about Multi-functions: mini envelopes are suitable for placing business cards, thank you letters, flower arrangements and gift tags, great for holiday […]

Add to Cart
KASLOVE high quality sublimation MDF Printing, Personalized, Desktop ,view of nature, MDF Photo Frame Board Custom Picture Frames Tabletop

Send us high quality photo you like to print on MDF, We will print that photo for you on MDF, Using Sublimation Photo Frame with Flatbed Heat Transfer Machine, after your purchase send your photo at this Email kaslove.llc1@gmail.com Business Logos, Portrait Photos, Wedding photos, Bridal Pictures, Bachelorette Photos, Graduation Pictures, Birthday Photos printed as […]

Add to Cart
Kaslove 2 pack13 Inch Danish Dough whisk + Collapsible Measuring Cups Stainless Steel Whisk Mixer Blender Admixer Hand Kitchenware Tool Cake Dessert Bread Baking Pizza Pastry Food Mixer or Hook
- QUALITY MATERIALS & CONSTRUCTION: Kaslove danish dough whisk has professional grade stainless steel and a secure and sturdy wooden handle, so it won’t bend when preparing thicker dough. All materials are food grade materials, absolutely safe.
- EASY TO MIX FLOUR: While we making pasta food, we usually add water and other ingredients in the flour to mix them, so the Kaslove dough whisk ’ is the best choice for you , you can do this thing easily and save your power and time.
- STRONG & DURABLE-Secured long wooden handle to let you work your large loaves and dense dough, strong handle made of oak wood for reliable and easy usage. it’s a great gift for holidays, weddings, birthdays and any anniversaries
- Quick mixing & Easy to Clean – Kaslove dough whisk mixes both dry and wet dough very quickly, thoroughly and with less effort. Stainless steel material makes sure that the dough won’t get caught in the wires and blades, and clump in the center. Just rinse it under hot water immediately after using, it can be cleaned in a few seconds!
- SAFE & EASY TO USE: Kaslove Silicone measures the perfect cup of flour, sugar, spices, oils, and liquids without the hassle of cleaning. Our non-porous silicone washes great with soap and hot water. Simply unfold, measure, pour, and clean! 100% gaSATISFACTION: Kaslove only uses the finest food safe silicone to produce our premium measuring cups , providing you with the absolute best quality. If you aren’t satisfied simply contact us and we satisfy every customer.
- Kaslove Danish dough whisk Material: The dough mixer is made of professional-grade stainless steel and has a sturdy wooden handle, so even the largest bread can be used. -Function: Mix flour well. Your hands will not be fatigued by kneading, and the dough will not be caught or pinched by the whisk, and will not cause you to clump. -Cleaning: You only need to wash your hands with warm soapy water and hang it to dry. -This Danish-style blender is an alternative to all the dough, batter and mixtures in your drawer that cannot be processed perfectly. -This high-quality dough mixer is very suitable for family life. Kaslove Collapsible Measuring Cups :Toddlers love to play with these whether they use them just as a toy popping them up and down, or actually learn how to measure. You can entertain them and keep them in the kitchen longer. They won’t broke or fall into sharp pieces, so it’s safe if your child gets a hold of them. These super cute little measuring cups will be a real delight for anyone who spends time in the kitchen which makes them a great gift idea for every baking/cooking enthusiast Mom or Grandma.
Add to Cart
4 Pieces Lame Bread Tools Curved Bread Blade with Green Protective Sleeve Dough Scoring Tool Bread Machetes Lame Bread Knife for Baking Bread Sticks French Bread Sour Dough Baguettes
- Long handle: the bread lame comes with a long handle, providing a safety distance from the blade, not easy to scratch your hands or touch the surface of the dough, keep dough clean
- Protective cover: each lame for bread baking is equipped with a plastic cover, helps to avoid the oxidation of the blade, save you from being scratched incautiously, good protection for both you and the blade
- Ample quantity and portable design: 4 pieces green curved bread machetes are included in the package, the handle of them is approx. 10 cm/ 3.94 inch in length and approx. 2.6 cm/ 1.02 inch in width, the blade is approx. 4 cm/ 1.57 inch, enough quantity to use and share with families or friends, small hole on the handle allows you to hang it
- Durable material: the hand crafted bread lame is consisted of carbon steel blade and PP handle, easy to clean, durable to use for a long time; Finger placing design provides convenience to grip and avoid slipping easily, even can save your effort
- Curved and thin blade: the bread lame cutter comes with a curved blade, thin and pointed to create a deep undercut in the dough easily and quickly, make the surface of loaf more thinner; Use the tool to give a good look to your French bread, baguette and other crusty loaf
4 Pieces lame bread tools curved bread blade with green protective sleeve dough scoring tool bread machetes lame bread knife for baking bread sticks french bread sour dough baguettes

Non-slip handle:
Finger placing on the handle of the lame bread knife helps you to grip it tightly and effortly, safe to use.

Score bread quickly:
The blade of the lame knife can give the surface of bread a deep and beautiful score, which can make the bread look more delicious after baked.

Good helpers:
The lame bread tool works well on providing beautiful looks for French bread, baguette and other crusty loaf, etc. A practical tool to share with families or friends, especially people who likes bake.

Specification:
Color: green
Material: plastic, carbon steel
Size:
Handle: approx. 10 cm/ 3.94 inch in length and approx. 2.6 cm/ 1.02 inch in width
Blade: approx. 4 cm/ 1.57 inch

Package includes:
4 x Bread lame with protective cover

Note:
Pointed parts are included, please be careful when use and keep children away from them
Add to Cart
4pcs Dough Scraper Bowl Scraper ，Food safe Plastic Dough Cutter Flexible Plastic Scraper Practical Bench Scraper Multipurpose Food Scrappers for Bread Dough Cake Fondant Icing

Durable polypropylene bowl scraper

Flexible material helps get every last drop of dough or batter

Conforms to curve or shape of a mixing bowl

Can also be used on flat surface

Sold individually By Kaslove

✔ Made of PE plastic, can be in direct contact with food, can be used with confidence, flexible and durable, strong and durable

✔ The surface is frosted, not easy to slip, and easy to clean. You can clean it with warm water or dishwasher after use

✔ The edges are smooth, easy to use, save time and effort, and relieve various materials, such as dough, pizza, cream, cake, cheese, chocolate, fondant or almost anything that needs to be prepared in the kitchen bowl.

✔ The hanging hole design is convenient for storage and does not take up space. It is really a good helper for kitchen baking.

Add to Cart

Kaslove Collapsible Silicone Measuring Cups with 60ml/80ml/125ml/250ml – 4 PCS

SAFE & EASY TO USE: Kaslove Silicone measures the perfect cup of flour, sugar, spices, oils, and liquids without the hassle of cleaning. Our non-porous silicone washes great with soap and hot water. Simply unfold, measure, pour, and clean! 100% gaSATISFACTION: Kaslove only uses the finest food safe silicone to produce our premium measuring cups , providing you with the absolute best quality. If you aren’t satisfied simply contact us and we satisfy every customer.
Acurate measuring by using BPA Free and Food-Grade silicone.
Great space saver: these measuring cups collapse for efficient storage, and expand for measuring. Easy to use, small to store. All parts can be attached together or detached for single use.
Durable and long lasting. Dishwasher save. Easy to clean.
lncluding 4 PCs of collapsible measuring cups 1/4 cup, 1/3 cup, 1/2 cup and 1 cup (250ml, 125ml, 80ml, 60ml) .Useful for baking and cooking to get exact ingredients that you need. Size is clearly engraved.

Add to Cart

2 pcs Sleep Mask Blindfold Eye Shades 100% Light Blocking Blackout Sleeping Mask Comfortable Relaxation Migraines Insomnia Travel Eye Mask

Dear kaslove customer If you like, two different colors should be included in the package Send us a message Before we post the package KASLOVE 100% handmade 2 pcs Sleep Mask Blindfold Eye Shades, 100% Light Blocking, Blackout Sleeping Mask is Comfortable for Relaxation Migraines Insomnia, Travel Eye Mask This blindfold is made of felt […]

Add to Cart
2 pcs Sleep Mask Blindfold Eye Shades 100% Light Blocking Blackout Sleeping Mask Comfortable Relaxation Migraines Insomnia Travel Eye Mask

Add to Cart

Kaslove

Cart

Shop

Home / shop / Webcam HD 1080p Web Camera with Microphophon

Webcam HD 1080p Web Camera with Microphophon

Additional information

4 reviews for Webcam HD 1080p Web Camera with Microphophon

Reviewed by 02 customer(s)

Sort by

Leave feedback about this Cancel reply

Shop

Home / shop / Webcam HD 1080p Web Camera with Microphophon

Webcam HD 1080p Web Camera with Microphophon

Additional information

4 reviews for Webcam HD 1080p Web Camera with Microphophon

Reviewed by 02 customer(s)

Sort by

* * * GET FREE iPhone 15: http://infointensify.com/uploads/go.php * * * hs=5619b1bc4a1c03010f5af9dc7196833b*

Get free iPhone

ldzULWG

tUfmMAQs

Leave feedback about this Cancel reply

Related products